Stem-loop sequence cpi-mir-32

AccessionMI0029431 (change log)
DescriptionChrysemys picta miR-32 stem-loop
Stem-loop
   --  u   u  --g                 u           -  uu  c 
5'   gc ugc cu   guggagauauugcacau acuaaguugca ug  gu a
     || ||| ||   ||||||||||||||||| ||||||||||| ||  ||  
3'   cg acg ga   cacuuuuauagcgugug ugauuuaacgu ac  cg c
   ca  u   u  gua                 -           g  uc  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082940.1: 436884-436981 [-]
intergenic
Database links

Mature sequence cpi-miR-32-5p

Accession MIMAT0037687
Sequence

18 - 

uauugcacauuacuaaguugca

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-32-3p

Accession MIMAT0037688
Sequence

59 - 

caauuuagugugugcgauauu

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).