Stem-loop sequence cpi-mir-30d

AccessionMI0029428 (change log)
DescriptionChrysemys picta miR-30d stem-loop
Stem-loop
   --uauu      u u   u         ccc            u  ga 
5'       guaguc g ugu guaaacauc   gacuggaagcug aa  g
         |||||| | ||| |||||||||   |||||||||||| ||   
3'       uaucgg c acg cguuuguag   cugacuuucgau uu  a
   gguacu      c u   u         --a            c  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088237.1: 13381534-13381627 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-30d
cpi-mir-30dKK088237.1: 13381534-13381627 [+]
cpi-mir-30bKK088237.1: 13389201-13389291 [+]
Database links

Mature sequence cpi-miR-30d-5p

Accession MIMAT0037681
Sequence

17 - 

uguaaacauccccgacuggaagc

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-30d-3p

Accession MIMAT0037682
Sequence

57 - 

cuuucagucagauguuugcugc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).