Stem-loop sequence cpi-mir-30c-2

AccessionMI0029427 (change log)
DescriptionChrysemys picta miR-30c-2 stem-loop
Stem-loop
   -a   cugagu      uacu       u   aca         guggaa 
5'   gcu      ggcagg    guaaaca ccu   cucucagcu      a
     |||      ||||||    ||||||| |||   |||||||||       
3'   cga      ccgucu    cauuugu gga   gagggucga      g
   ga   aagguu      cucu       c   --a         aggaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083109.1: 125616-125714 [-]
intergenic
Database links

Mature sequence cpi-miR-30c-5p

Accession MIMAT0037678
Sequence

20 - 

uguaaacauccuacacucucagcu

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-30c-2-3p

Accession MIMAT0037680
Sequence

60 - 

cugggagaaggcuguuuacucu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).