Stem-loop sequence cpi-mir-27a

AccessionMI0029418 (change log)
DescriptionChrysemys picta miR-27a stem-loop
Stem-loop
   ----  ua      u  a         u   c        -  guu  c 
5'     ga  ccgggg gc gggcuuagc cac ugugaaca ga   cg a
       ||  |||||| || ||||||||| ||| |||||||| ||   ||  
3'     cu  ggcccc cg cuugaaucg gug acacuugu cu   gc u
   uugc  gg      c  c         -   -        g  -au  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088216.1: 354904-354995 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-27a
cpi-mir-23aKK088216.1: 354537-354628 [+]
cpi-mir-27aKK088216.1: 354904-354995 [+]
cpi-mir-24-2KK088216.1: 355115-355209 [+]
Database links

Mature sequence cpi-miR-27a-5p

Accession MIMAT0037664
Sequence

14 - 

agggcuuagcucaccugugaa

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-27a-3p

Accession MIMAT0037665
Sequence

57 - 

uucacaguggcuaaguuccgc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).