Stem-loop sequence cpi-mir-26-3

AccessionMI0029417 (change log)
DescriptionChrysemys picta miR-26-3 stem-loop
Stem-loop
   ---c ga       g    -  u         c           -ug  c 
5'     g  ggccggc ccgg gu caaguaauc aggauaggcug   gu u
       |  ||||||| |||| || ||||||||| |||||||||||   ||  
3'     c  ccggccg ggcc cg guucauuag ucuuguccggc   cg g
   ucga gg       a    g  -         c           uga  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082919.1: 1627705-1627800 [-]
intergenic
Database links

Mature sequence cpi-miR-26-5p

Accession MIMAT0037660
Sequence

18 - 

uucaaguaauccaggauaggcu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-26-3-3p

Accession MIMAT0037663
Sequence

57 - 

ccuguucucgauuacuuggcgc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).