Stem-loop sequence cpi-mir-22

AccessionMI0029410 (change log)
DescriptionChrysemys picta miR-22 stem-loop
Stem-loop
   ---cc     acuag  c           -     a      c  cc  g 
5'      ggcua     ca caguucuucag uggca gcuuua gu  cu u
        |||||     || ||||||||||| ||||| |||||| ||  ||  
3'      ccgau     gu gucaagaaguu accgu cgaaau cg  ga c
   ucuca     -guaa  u           g     -      -  ac  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082936.1: 7650182-7650276 [+]
intergenic
Database links

Mature sequence cpi-miR-22-5p

Accession MIMAT0037653
Sequence

17 - 

aguucuucaguggcaagcuuua

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-22-3p

Accession MIMAT0037654
Sequence

58 - 

aagcugccaguugaagaacugu

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).