Stem-loop sequence cpi-mir-20b

AccessionMI0029408 (change log)
DescriptionChrysemys picta miR-20b stem-loop
Stem-loop
   --       cua       -ca           g     g   u   ug 
5'   uuuuguc   gcaguau   aagugcucaua ugcag uag uuu  a
     |||||||   |||||||   ||||||||||| ||||| ||| |||   
3'   aaaauag   cgucaug   uucacgggugu auguc auc agg  a
   gu       -ac       aua           a     -   u   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088187.1: 4591349-4591443 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-20b
cpi-mir-106aKK088187.1: 4591728-4591805 [-]
cpi-mir-18bKK088187.1: 4591575-4591651 [-]
cpi-mir-20bKK088187.1: 4591349-4591443 [-]
cpi-mir-19b-2KK088187.1: 4591224-4591323 [-]
cpi-mir-92a-2KK088187.1: 4591087-4591173 [-]
cpi-mir-363KK088187.1: 4590949-4591039 [-]
Database links

Mature sequence cpi-miR-20b-5p

Accession MIMAT0037649
Sequence

18 - 

caaagugcucauagugcaggua

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-20b-3p

Accession MIMAT0037650
Sequence

57 - 

acuguaaugugggcacuuauagu

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).