Stem-loop sequence cpi-mir-19b-2

AccessionMI0029406 (change log)
DescriptionChrysemys picta miR-19b-2 stem-loop
Stem-loop
   aa  --u     u                   -     -   uuc    uuau 
5'   ga   agugc gacuacagucaguuuugca ggauu gca   cagc    u
     ||   ||||| ||||||||||||||||||| ||||| |||   ||||    u
3'   cu   uuacg uuggugucagucaaaacgu ccuaa cgu   gucg    c
   -g  uac     -                   a     a   ---    caaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088187.1: 4591224-4591323 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-19b-2
cpi-mir-106aKK088187.1: 4591728-4591805 [-]
cpi-mir-18bKK088187.1: 4591575-4591651 [-]
cpi-mir-20bKK088187.1: 4591349-4591443 [-]
cpi-mir-19b-2KK088187.1: 4591224-4591323 [-]
cpi-mir-92a-2KK088187.1: 4591087-4591173 [-]
cpi-mir-363KK088187.1: 4590949-4591039 [-]
Database links

Mature sequence cpi-miR-19b-2-5p

Accession MIMAT0037646
Sequence

22 - 

aguuuugcaggauugcauucc

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-19b-3p

Accession MIMAT0037645
Sequence

59 - 

ugugcaaauccaugcaaaacug

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).