Stem-loop sequence cpi-mir-18a

AccessionMI0029402 (change log)
DescriptionChrysemys picta miR-18a stem-loop
Stem-loop
   --u         u   --   u   uc   u    a   -  aa u 
5'    gcuuuuugu cua  agg gca  uag gcag uag ug  g a
      ||||||||| |||  ||| |||  ||| |||| ||| ||  | g
3'    ugaagaaua ggu  ucc cgu  auc cguc auc ac  u a
   uau         c   cu   u   ga   c    -   u  ga u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083096.1: 1397132-1397220 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-18a
cpi-mir-17KK083096.1: 1397279-1397364 [-]
cpi-mir-18aKK083096.1: 1397132-1397220 [-]
cpi-mir-19aKK083096.1: 1396986-1397085 [-]
cpi-mir-20aKK083096.1: 1396807-1396898 [-]
cpi-mir-19b-1KK083096.1: 1396664-1396757 [-]
cpi-mir-92a-1KK083096.1: 1396547-1396640 [-]
Database links

Mature sequence cpi-miR-18a-5p

Accession MIMAT0037638
Sequence

13 - 

uaaggugcaucuagugcaga

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-18a-3p

Accession MIMAT0037639
Sequence

54 - 

acugcccuaagugcuccuucug

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).