Stem-loop sequence cpi-mir-16a

AccessionMI0029400 (change log)
DescriptionChrysemys picta miR-16a stem-loop
Stem-loop
   ca  ag   a          -  a        c uuaacuc 
5'   gc  uac uuagcagcac gu aauauugg g       u
     ||  ||| |||||||||| || |||||||| |        
3'   ug  aug agucgucgug ca uuaugacc c       g
   --  aa   a          u  a        u uauaaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
chr1: 56259040-56259120 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-16a
cpi-mir-15achr1: 56259174-56259256 [-]
cpi-mir-16achr1: 56259040-56259120 [-]
Database links

Mature sequence cpi-miR-16a-5p

Accession MIMAT0037634
Sequence

12 - 

uagcagcacguaaauauuggcg

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-16a-3p

Accession MIMAT0037635
Sequence

52 - 

ccaguauuaacugugcugcuga

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).