Stem-loop sequence cpi-mir-10b

AccessionMI0029396 (change log)
DescriptionChrysemys picta miR-10b stem-loop
Stem-loop
   ----uauua     u        a    g     c          -ug  au 
5'          cguug cuauauau cccu uagaa cgaauuugug   gu  u
            ||||| |||||||| |||| ||||| ||||||||||   ||   
3'          guagc gguauaua gggg aucuu gcuuagacac   ua  c
   uucaaaaac     u        a    -     a          uga  ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088176.1: 6311506-6311605 [-]
intergenic
Database links

Mature sequence cpi-miR-10b-5p

Accession MIMAT0037627
Sequence

19 - 

uacccuguagaaccgaauuugu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-10b-3p

Accession MIMAT0037628
Sequence

60 - 

agauucgauucuaggggaau

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).