Stem-loop sequence cpi-mir-9-4

AccessionMI0029394 (change log)
DescriptionChrysemys picta miR-9-4 stem-loop
Stem-loop
   -------gac     ug       uc       a       g     g   a 
5'           ugggu  guuuuug  uuugguu ucuagcu uauga ugu u
             |||||  |||||||  ||||||| ||||||| ||||| ||| g
3'           acuua  caaaaau  aagccaa agaucga auacu aua u
   accucuuauc     gu       gu       g       a     -   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082993.1: 1808956-1809054 [+]
intergenic
Database links

Mature sequence cpi-miR-9-5p

Accession MIMAT0037622
Sequence

18 - 

ucuuugguuaucuagcuguauga

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-9-4-3p

Accession MIMAT0037624
Sequence

56 - 

uaaagcuagagaaccgaaugua

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).