Stem-loop sequence cpi-mir-9-2

AccessionMI0029392 (change log)
DescriptionChrysemys picta miR-9-2 stem-loop
Stem-loop
   -cu    ---g    c     g   uc               g      u ug 
5'    guga    gaag gaguu uua  uuugguuaucuagcu uaugag g  u
      ||||    |||| ||||| |||  ||||||||||||||| |||||| |  u
3'    uacu    cuuc cucaa aau  aagccaauagaucga auacuu c  g
   ugc    agua    -     a   ga               a      - ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082917.1: 3125064-3125166 [+]
intergenic
Database links

Mature sequence cpi-miR-9-5p

Accession MIMAT0037622
Sequence

22 - 

ucuuugguuaucuagcuguauga

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-9-3p

Accession MIMAT0037623
Sequence

60 - 

uaaagcuagauaaccgaaagua

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).