Stem-loop sequence cpi-mir-7b

AccessionMI0029390 (change log)
DescriptionChrysemys picta miR-7b stem-loop
Stem-loop
   ---       u g  cu   a    u u     --    -      agu 
5'    uucuggg c gu  gga gacu g gauuu  uguu guuucc   g
      ||||||| | ||  ||| |||| | |||||  |||| ||||||    
3'    aggaccc g ca  ccu cuga c cuaaa  acaa cgaagg   u
   guc       c a  cu   -    c -     ca    g      gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083007.1: 3181798-3181889 [+]
intergenic
Database links

Mature sequence cpi-miR-7b-5p

Accession MIMAT0037621
Sequence

14 - 

uggaagacuugugauuuuguugu

 - 36

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).