Stem-loop sequence cpi-mir-7a-3

AccessionMI0029389 (change log)
DescriptionChrysemys picta miR-7a-3 stem-loop
Stem-loop
   -----a       gcu        a  a   g      u      cug    a 
5'       uggucug   cugugugg ag cua ugauuu guuguu   acuu u
         |||||||   |||||||| || ||| |||||| ||||||   ||||  
3'       accaggc   gacauacc uc gau acuaaa caacag   ugaa a
   accgac       -ac        g  c   -      -      ---    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082934.1: 5983561-5983657 [-]
intergenic
Database links

Mature sequence cpi-miR-7a-5p

Accession MIMAT0037617
Sequence

17 - 

uggaagacuagugauuuuguu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-7a-3-3p

Accession MIMAT0037620
Sequence

58 - 

caacaaaucauagccugccaua

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).