Stem-loop sequence cpi-mir-7a-2

AccessionMI0029388 (change log)
DescriptionChrysemys picta miR-7a-2 stem-loop
Stem-loop
   ---u    cc uc  u  u  a     a       u      cuauagc 
5'     ggcc  g  cc ua gg agacu gugauuu guuguu       u
       ||||  |  || || || ||||| ||||||| ||||||        
3'     ccgg  c  gg au cc ucuga cacugaa caacag       c
   uccu    ua gu  u  u  g     -       -      uacucua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088241.1: 3107639-3107733 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-7a-2
cpi-mir-7a-2KK088241.1: 3107639-3107733 [-]
cpi-mir-1720KK088241.1: 3107406-3107477 [-]
Database links

Mature sequence cpi-miR-7a-5p

Accession MIMAT0037617
Sequence

16 - 

uggaagacuagugauuuuguu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-7a-2-3p

Accession MIMAT0037619
Sequence

58 - 

caacaagucacagucugccuu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).