Stem-loop sequence cpi-mir-7a-1

AccessionMI0029387 (change log)
DescriptionChrysemys picta miR-7a-1 stem-loop
Stem-loop
   ---  augu      a  u        a     a       u      --     a 
5'    gg    uggucu gu cugugugg agacu gugauuu guuguu  uuuag u
      ||    |||||| || |||||||| ||||| ||||||| ||||||  |||||  
3'    cc    accgga ca gguauacc ucuga cgcuaaa caacag  aaauc a
   ucu  --gu      -  c        g     -       -      cu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083268.1: 510126-510229 [+]
intergenic
Database links

Mature sequence cpi-miR-7a-5p

Accession MIMAT0037617
Sequence

22 - 

uggaagacuagugauuuuguu

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-7a-3p

Accession MIMAT0037618
Sequence

64 - 

caacaaaucgcagucugccaua

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).