Stem-loop sequence cpi-mir-1b

AccessionMI0029386 (change log)
DescriptionChrysemys picta miR-1b stem-loop
Stem-loop
   -a     ucccu     ccc            c    gc      gga   a 
5'   gcccc     cccaa   uacauacuucuu auau  ccauag   guc g
     |||||     |||||   |||||||||||| ||||  ||||||   |||  
3'   ugggg     ggguu   auguaugaagaa ugua  gguauu   cgg c
   cc     ---uc     ccu            u    -a      --g   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
chr19: 4210814-4210912 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-1b
cpi-mir-1bchr19: 4210814-4210912 [+]
cpi-mir-133cchr19: 4211024-4211123 [+]
Database links

Mature sequence cpi-miR-1b-5p

Accession MIMAT0037615
Sequence

22 - 

cauacuucuucauaugcccaua

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-1b-3p

Accession MIMAT0037616
Sequence

62 - 

uggaauguuaagaaguauguau

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).