Stem-loop sequence cpi-mir-1a-2

AccessionMI0029385 (change log)
DescriptionChrysemys picta miR-1a-2 stem-loop
Stem-loop
   ----u      c                     ac     ugaaca 
5'      ccugcc agaguacauacuucuuuaugu  ccaua      u
        |||||| |||||||||||||||||||||  |||||       
3'      ggacgg uuuuauguaugaagaaaugua  gguau      a
   gucac      u                     -a     cguaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088180.1: 6518113-6518201 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-mir-1a-2
cpi-mir-1a-2KK088180.1: 6518113-6518201 [-]
cpi-mir-133a-1KK088180.1: 6514695-6514784 [-]
Database links

Mature sequence cpi-miR-1a-2-5p

Accession MIMAT0037614
Sequence

14 - 

acauacuucuuuauguacccaua

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-1a-3p

Accession MIMAT0037613
Sequence

53 - 

uggaauguaaagaaguauguau

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).