Stem-loop sequence cpi-mir-1a-1

AccessionMI0029384 (change log)
DescriptionChrysemys picta miR-1a-1 stem-loop
Stem-loop
   ----cua  ug       g                gc     ugaacc 
5'        cc  cuugaga acauacuucuuuauau  ccaua      u
          ||  ||||||| ||||||||||||||||  |||||       
3'        gg  ggacuuu uguaugaagaaaugua  gguau      g
   uuacuag  gu       a                -a     cgaacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088178.1: 3459667-3459759 [+]
intergenic
Database links

Mature sequence cpi-miR-1a-5p

Accession MIMAT0037612
Sequence

16 - 

acauacuucuuuauaugcccaua

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-miR-1a-3p

Accession MIMAT0037613
Sequence

55 - 

uggaauguaaagaaguauguau

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).