Stem-loop sequence cpi-let-7i

AccessionMI0029383 (change log)
DescriptionChrysemys picta let-7i stem-loop
Stem-loop
   ---cc     u                 u   --------  u     ugu 
5'      cuggc gagguaguaguuugugc guu        gg cgggu   g
        ||||| ||||||||||||||||| |||        || |||||   a
3'      gaucg uuccgucaucgaacgcg caa        uc gcccg   c
   gucgu     -                 u   uagaggug  -     uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK082989.1: 2620659-2620750 [+]
intergenic
Database links

Mature sequence cpi-let-7i-5p

Accession MIMAT0037610
Sequence

8 - 

ugagguaguaguuugugcuguu

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-let-7i-3p

Accession MIMAT0037611
Sequence

64 - 

cugcgcaagcuacugccuugcu

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).