Stem-loop sequence cpi-let-7g

AccessionMI0029382 (change log)
DescriptionChrysemys picta let-7g stem-loop
Stem-loop
   -       u        a            ugagg    -a  a    a 
5'  uccaggc gagguagu guuuguacaguu     gucu  ug uacc c
    ||||||| |||||||| ||||||||||||     ||||  || ||||  
3'  ggguccg uuccguca cggacaugucaa     uaga  ac augg c
   a       -        c            -----    gg  -    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083011.1: 2949169-2949259 [+]
intergenic
Database links

Mature sequence cpi-let-7g-5p

Accession MIMAT0037608
Sequence

8 - 

ugagguaguaguuuguacaguu

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-let-7g-3p

Accession MIMAT0037609
Sequence

65 - 

cuguacaggccacugccuugc

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).