Stem-loop sequence cpi-let-7f-2

AccessionMI0029381 (change log)
DescriptionChrysemys picta let-7f-2 stem-loop
Stem-loop
   -g   a ug                      ---------       u 
5'   cgg g  agguaguagauuguauaguugu         aggguag u
     ||| |  ||||||||||||||||||||||         ||||||| a
3'   gcc c  uccguuaucuaacauaucaaua         ucccauu u
   ga   - cu                      gaggacuug       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088242.1: 1330625-1330712 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-let-7f-2
cpi-let-7a-1KK088242.1: 1330114-1330212 [+]
cpi-let-7f-2KK088242.1: 1330625-1330712 [+]
cpi-let-7dKK088242.1: 1331717-1331804 [+]
Database links

Mature sequence cpi-let-7f-5p

Accession MIMAT0037606
Sequence

7 - 

ugagguaguagauuguauaguu

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-let-7f-3p

Accession MIMAT0037607
Sequence

63 - 

cuauacaaucuauugccuucc

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).