Stem-loop sequence cpi-let-7f-1

AccessionMI0029380 (change log)
DescriptionChrysemys picta let-7f-1 stem-loop
Stem-loop
   ccgaggcccugg    u   gu                uuagggucacac 
5'             ggga gag  aguagauuguauaguu            c
               |||| |||  ||||||||||||||||             
3'             cccu uuc  ucaucugacauaucaa            c
   -----------g    -   ug                uagaggcucugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083246.1: 398670-398759 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-let-7f-1
cpi-let-7f-1KK083246.1: 398670-398759 [-]
cpi-mir-98KK083246.1: 398069-398149 [-]
Database links

Mature sequence cpi-let-7f-5p

Accession MIMAT0037606
Sequence

17 - 

ugagguaguagauuguauaguu

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).