Stem-loop sequence cpi-let-7e

AccessionMI0029379 (change log)
DescriptionChrysemys picta let-7e stem-loop
Stem-loop
   -g     g   cu   gu         a      -  ------    uc 
5'   uccuu agg  gag  aguagauug auaguu gu      ggag  c
     ||||| |||  |||  ||||||||| |||||| ||      ||||  u
3'   aggaa ucc  uuc  ucaucuaac uaucaa cg      ccuc  a
   ag     -   -u   ug         a      u  aguuuc    cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
chr4: 2386096-2386186 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-let-7e
cpi-let-7echr4: 2386096-2386186 [+]
cpi-let-7a-4chr4: 2386302-2386391 [+]
Database links

Mature sequence cpi-let-7e-5p

Accession MIMAT0037604
Sequence

12 - 

ugagguaguagauugaauaguu

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-let-7e-3p

Accession MIMAT0037605
Sequence

62 - 

cuauacaaucuacugucuuu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).