Stem-loop sequence cpi-let-7d

AccessionMI0029378 (change log)
DescriptionChrysemys picta let-7d stem-loop
Stem-loop
   -----     a              c      -------uua         
5'      uagga gagguaguagguug auaguu          gggcagag 
        ||||| |||||||||||||| ||||||          ||||||| a
3'      auucu uuccgucguccaac uaucaa          cucguuuu 
   ucggg     -              a      uugaggaaca         
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088242.1: 1331717-1331804 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-let-7d
cpi-let-7a-1KK088242.1: 1330114-1330212 [+]
cpi-let-7f-2KK088242.1: 1330625-1330712 [+]
cpi-let-7dKK088242.1: 1331717-1331804 [+]
Database links

Mature sequence cpi-let-7d-5p

Accession MIMAT0037602
Sequence

6 - 

agagguaguagguugcauaguu

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-let-7d-3p

Accession MIMAT0037603
Sequence

60 - 

cuauacaaccugcugccuuucu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).