Stem-loop sequence cpi-let-7c-2

AccessionMI0029377 (change log)
DescriptionChrysemys picta let-7c-2 stem-loop
Stem-loop
   ---u  -          cu   g   u             uagaauaaca 
5'     gc gugccccagg  gag uag agguuguaugguu          c
       || ||||||||||  ||| ||| |||||||||||||           
3'     cg cgcggggucc  uuc auc uccgacaugucaa          c
   gauu  u          cu   g   c             uagaggacgc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK083354.1: 288926-289023 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-let-7c-2
cpi-mir-99bKK083354.1: 287396-287489 [+]
cpi-let-7c-2KK083354.1: 288926-289023 [+]
cpi-mir-125aKK083354.1: 295798-295885 [+]
Database links

Mature sequence cpi-let-7c-5p

Accession MIMAT0037599
Sequence

15 - 

ugagguaguagguuguaugguu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-let-7c-2-3p

Accession MIMAT0037601
Sequence

61 - 

cuguacagccuccuagcuuucc

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).