Stem-loop sequence cpi-let-7c-1

AccessionMI0029376 (change log)
DescriptionChrysemys picta let-7c-1 stem-loop
Stem-loop
   -----      a      uu   g   u             ua  g ua a 
5'      gugugc uccggg  gag uag agguuguaugguu  ga u  c c
        |||||| ||||||  ||| ||| |||||||||||||  || |  | c
3'      cacacg agguuc  uuc auc uccaacaugucaa  uu a  g c
   ggguu      -      cu   g   u             --  g gg u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088228.1: 9003448-9003544 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-let-7c-1
cpi-mir-99aKK088228.1: 9002704-9002796 [+]
cpi-let-7c-1KK088228.1: 9003448-9003544 [+]
Database links

Mature sequence cpi-let-7c-5p

Accession MIMAT0037599
Sequence

15 - 

ugagguaguagguuguaugguu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-let-7c-3p

Accession MIMAT0037600
Sequence

60 - 

cuguacaaccuucuagcuuucc

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).