Stem-loop sequence cpi-let-7b

AccessionMI0029375 (change log)
DescriptionChrysemys picta let-7b stem-loop
Stem-loop
   gcucuag     u                     ucaggguagugauuu 
5'        caggg gagguaguagguugugugguu               u
          ||||| |||||||||||||||||||||                
3'        guccc uuccgucauccaacauaucaa               g
   -------     -                     uagaggacuaacccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088200.1: 3678396-3678487 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-let-7b
cpi-let-7a-3KK088200.1: 3680143-3680235 [-]
cpi-let-7bKK088200.1: 3678396-3678487 [-]
Database links

Mature sequence cpi-let-7b-5p

Accession MIMAT0037598
Sequence

13 - 

ugagguaguagguugugugguu

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).