Stem-loop sequence cpi-let-7a-4

AccessionMI0029374 (change log)
DescriptionChrysemys picta let-7a-4 stem-loop
Stem-loop
   --ug    u          gu         ---ugg  gg -       
5'     gagg gagguaguag  uguauaguu      ug  a gggauu 
       |||| ||||||||||  |||||||||      ||  | ||||| u
3'     uucc uuccguuauc  acauaucaa      ac  u cccuac 
   gaaa    -          ug         uagugg  uu a       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
chr4: 2386302-2386391 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-let-7a-4
cpi-let-7echr4: 2386096-2386186 [+]
cpi-let-7a-4chr4: 2386302-2386391 [+]
Database links

Mature sequence cpi-let-7a-5p

Accession MIMAT0037594
Sequence

7 - 

ugagguaguagguuguauaguu

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-let-7a-4-3p

Accession MIMAT0037597
Sequence

64 - 

cuauacagucuauugccuucc

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).