Stem-loop sequence cpi-let-7a-3

AccessionMI0029373 (change log)
DescriptionChrysemys picta let-7a-3 stem-loop
Stem-loop
   -   -   ug   u   gu                ---------u     u 
5'  guc cuu  ggg gag  aguagguuguauaguu          uaggg u
    ||| |||  ||| |||  ||||||||||||||||          ||||| a
3'  cgg gaa  ccu uuc  ucaucuaacauaucaa          guccc u
   u   u   gu   -   ug                uagacugucc     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088200.1: 3680143-3680235 [-]
intergenic
Clustered miRNAs
< 10kb from cpi-let-7a-3
cpi-let-7a-3KK088200.1: 3680143-3680235 [-]
cpi-let-7bKK088200.1: 3678396-3678487 [-]
Database links

Mature sequence cpi-let-7a-5p

Accession MIMAT0037594
Sequence

12 - 

ugagguaguagguuguauaguu

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-let-7a-3p

Accession MIMAT0037595
Sequence

62 - 

cuauacaaucuacugucuuu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).