Stem-loop sequence cpi-let-7a-1

AccessionMI0029371 (change log)
DescriptionChrysemys picta let-7a-1 stem-loop
Stem-loop
   c    -a  g     u   gu                uuagg   aua    c 
5'  cugc  cu uggga gag  aguagguuguauaguu     guc   ccca a
    ||||  || ||||| |||  ||||||||||||||||     |||   ||||  
3'  gacg  ga auccu uuc  ucaucuaacauaucaa     uag   gggu a
   a    ac  a     -   ug                -----   --a    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Chrysemys_picta_bellii-3.0.3; GCA_000241765.2) Overlapping transcripts
KK088242.1: 1330114-1330212 [+]
intergenic
Clustered miRNAs
< 10kb from cpi-let-7a-1
cpi-let-7a-1KK088242.1: 1330114-1330212 [+]
cpi-let-7f-2KK088242.1: 1330625-1330712 [+]
cpi-let-7dKK088242.1: 1331717-1331804 [+]
Database links

Mature sequence cpi-let-7a-5p

Accession MIMAT0037594
Sequence

15 - 

ugagguaguagguuguauaguu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpi-let-7a-3p

Accession MIMAT0037595
Sequence

66 - 

cuauacaaucuacugucuuu

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).