Stem-loop sequence xtr-mir-551b

AccessionMI0029370 (change log)
DescriptionXenopus tropicalis miR-551b stem-loop
Stem-loop
   -----uga              cu      a a   -   ucu 
5'         ccuuagaaaucaag  uggguu g ccu ggu   u
           ||||||||||||||  |||||| | ||| |||    
3'         ggagucuuugguuc  acccag c gga uca   a
   gugaaguc              au      - -   g   cau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr5: 101175007-101175086 [-]
intergenic
Database links

Mature sequence xtr-miR-551b-3p

Accession MIMAT0037593
Sequence

48 - 

ggcgacccauacuugguuucu

 - 68

Get sequence
Evidence not experimental

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).