Stem-loop sequence aca-mir-9577

AccessionMI0029366 (change log)
DescriptionAnolis carolinensis miR-9577 stem-loop
Stem-loop
   c  u   a   u   -     c           --ca  au 
5'  cc ucu cac ggc ccaaa ucuuaugaaau    gu  u
    || ||| ||| ||| ||||| |||||||||||    ||  u
3'  gg gga gug ucg gguuu agaguacuuua    cg  a
   c  c   c   c   u     a           accc  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr5: 87965757-87965838 [-]
intergenic
Database links

Mature sequence aca-miR-9577-5p

Accession MIMAT0037588
Sequence

12 - 

uggcccaaacucuuaugaaauc

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-9577-3p

Accession MIMAT0037589
Sequence

51 - 

uuucaugagaauuuggugcucg

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).