Stem-loop sequence aca-mir-9576

AccessionMI0029365 (change log)
DescriptionAnolis carolinensis miR-9576 stem-loop
Stem-loop
   ---ucccagg     u     c          -uc    uua 
5'           uuccu cuaca ugccauauaa   caga   u
             ||||| ||||| ||||||||||   ||||    
3'           aagga gaugu acgguauauu   guuu   c
   uuuucuuugg     -     a          uua    ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343418.1: 621254-621334 [-]
intergenic
Database links

Mature sequence aca-miR-9576-5p

Accession MIMAT0037586
Sequence

12 - 

uucuacacugccauauaaucca

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-9576-3p

Accession MIMAT0037587
Sequence

48 - 

auuuuauauggcaauguagagg

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).