Stem-loop sequence aca-mir-9575

AccessionMI0029364 (change log)
DescriptionAnolis carolinensis miR-9575 stem-loop
Stem-loop
   c    --c   c u          ga        aua  gu 
5'  ucua   agu c ucucaaaaug  aacaggaa   ga  c
    ||||   ||| | ||||||||||  ||||||||   ||   
3'  agau   uca g agaguuuuac  uuguucuu   cu  a
   a    auu   a u          ug        -ca  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343665.1: 173374-173454 [-]
intergenic
Database links

Mature sequence aca-miR-9575-5p

Accession MIMAT0037584
Sequence

12 - 

uucucaaaauggaaacaggaa

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-9575-3p

Accession MIMAT0037585
Sequence

49 - 

ucuuguugucauuuugagauga

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).