Stem-loop sequence aca-mir-5396b

AccessionMI0029362 (change log)
DescriptionAnolis carolinensis miR-5396b stem-loop
Stem-loop
   gcc   a          ca     c             auaaga 
5'    cag auggggcauc  cacaa cagcaagaaggaa      u
      ||| ||||||||||  ||||| |||||||||||||       
3'    guc uacuccgugg  guguu gucguucuucuuu      u
   aca   c          ac     u             cccuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 213792650-213792739 [-]
intergenic
Database links

Mature sequence aca-miR-5396b-5p

Accession MIMAT0037580
Sequence

17 - 

ccacacaaccagcaagaaggaa

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-5396b-3p

Accession MIMAT0037581
Sequence

55 - 

ucuucuugcuguuugugcaggu

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).