Stem-loop sequence aca-mir-302a

AccessionMI0029357 (change log)
DescriptionAnolis carolinensis miR-302a stem-loop
Stem-loop
      c    uu               guuuuugu 
5' cca uacu  aauaugaaaguacuu        u
   ||| ||||  |||||||||||||||         
3' ggu guga  uuauacuuucgugaa        c
      a    uu               aaauuuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr5: 142963789-142963856 [+]
intergenic
Clustered miRNAs
< 10kb from aca-mir-302a
aca-mir-302bchr5: 142962973-142963049 [+]
aca-mir-302achr5: 142963789-142963856 [+]
aca-mir-367chr5: 142964147-142964214 [+]
Database links

Mature sequence aca-miR-302a-3p

Accession MIMAT0037572
Sequence

44 - 

aagugcuuucauauuuuaguga

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).