Stem-loop sequence aca-mir-133b

AccessionMI0029354 (change log)
DescriptionAnolis carolinensis miR-133b stem-loop
Literature search

2 open access papers mention aca-mir-133b
(8 sentences)

Stem-loop
   --acu g  uc     c        c      a    c    g  uu 
5'      u ag  cugcu uggcuggu aaaggg acca ggcu uc  c
        | ||  ||||| |||||||| |||||| |||| |||| ||   
3'      a uc  gacga aucgacca uuuccc uggu uugg ag  c
   acuau g  cu     c        a      c    -    a  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 122859594-122859686 [+]
intergenic
Clustered miRNAs
< 10kb from aca-mir-133b
aca-mir-206chr1: 122853025-122853117 [+]
aca-mir-133bchr1: 122859594-122859686 [+]
Database links

Mature sequence aca-miR-133b-5p

Accession MIMAT0037567
Sequence

18 - 

gcuggucaaagggaaccacggc

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-133b-3p

Accession MIMAT0037568
Sequence

55 - 

uuugguccccuuuaaccagcua

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).