Stem-loop sequence aca-mir-133a-3

AccessionMI0029353 (change log)
DescriptionAnolis carolinensis miR-133a-3 stem-loop
Literature search

2 open access papers mention aca-mir-133a-3
(8 sentences)

Stem-loop
   ugu   c   g       aaa    -a        g cu g 
5'    guc cua ggcuggu   aagg  accagauc a  g c
      ||| ||| |||||||   ||||  |||||||| |  |  
3'    cgg ggu ucgacca   uucc  ugguuuag u  c a
   ---   u   g       -ac    cc        g -- a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343308.1: 91297-91373 [+]
intergenic
Clustered miRNAs
< 10kb from aca-mir-133a-3
aca-mir-1bGL343308.1: 91113-91211 [+]
aca-mir-133a-3GL343308.1: 91297-91373 [+]
Database links

Mature sequence aca-miR-133a-3p

Accession MIMAT0037566
Sequence

49 - 

uuugguccccuucaaccagcug

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).