Stem-loop sequence aca-mir-26-3

AccessionMI0029350 (change log)
DescriptionAnolis carolinensis miR-26-3 stem-loop
Literature search

1 open access papers mention aca-mir-26-3
(2 sentences)

Stem-loop
   aa    u ag     uu         c            u  ca 
5'   ggcu c  ccugg  caaguaauc aggauaggcugu ac  g
     |||| |  |||||  ||||||||| |||||||||||| ||   
3'   ccgg g  ggacu  guucauuag ucuuauccggca ug  g
   --    c ga     uu         u            -  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 67040500-67040586 [-]
intergenic
Database links

Mature sequence aca-miR-26-3-5p

Accession MIMAT0037561
Sequence

16 - 

uucaaguaauccaggauaggcu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-26-3p

Accession MIMAT0037562
Sequence

53 - 

ggccuauucuugauuacuuguuu

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).