Stem-loop sequence aca-let-7a-2

AccessionMI0029348 (change log)
DescriptionAnolis carolinensis let-7a-2 stem-loop
Literature search

1 open access papers mention aca-let-7a-2
(1 sentences)

Stem-loop
   --   u          gu         ---- g  gg -       
5'   agg gagguaguag  uguauaguu    u ug  a gggauu 
     ||| ||||||||||  |||||||||    | ||  | ||||| a
3'   ucc uuccguuauc  acauaucaa    g ac  u cccuac 
   au   -          ug         uagu g  uu a       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr4: 123683312-123683394 [-]
intergenic
Clustered miRNAs
< 10kb from aca-let-7a-2
aca-let-7echr4: 123683599-123683700 [-]
aca-let-7a-2chr4: 123683312-123683394 [-]
Database links

Mature sequence aca-let-7a-5p

Accession MIMAT0021692
Previous IDsaca-let-7a
Sequence

4 - 

ugagguaguagguuguauaguu

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-let-7a-2-3p

Accession MIMAT0037559
Sequence

60 - 

cuauacagucuauugccuuccu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).