Stem-loop sequence aca-let-7a-3

AccessionMI0029347 (change log)
DescriptionAnolis carolinensis let-7a-3 stem-loop
Literature search

1 open access papers mention aca-let-7a-3
(1 sentences)

Stem-loop
      u   gu                ---------u     u 
5' ggg gag  aguagguuguauaguu          uaggg u
   ||| |||  ||||||||||||||||          ||||| c
3' ucc uuc  ucaucuaacauaucaa          guccc u
      u   ug                uacacugucc     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr5: 83533339-83533414 [-]
intergenic
Clustered miRNAs
< 10kb from aca-let-7a-3
aca-let-7a-3chr5: 83533339-83533414 [-]
aca-let-7bchr5: 83532327-83532421 [-]
Database links

Mature sequence aca-let-7a-5p

Accession MIMAT0021692
Previous IDsaca-let-7a
Sequence

4 - 

ugagguaguagguuguauaguu

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-let-7a-3-3p

Accession MIMAT0037558
Sequence

54 - 

cuauacaaucuacugucuuuc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).