Stem-loop sequence aca-let-7c-3

AccessionMI0029346 (change log)
DescriptionAnolis carolinensis let-7c-3 stem-loop
Literature search

1 open access papers mention aca-let-7c-3
(1 sentences)

Stem-loop
   ---   ---      uu   g   u             uagaa ua a 
5'    gca   uccagg  gag uag agguuguaugguu     u  c c
      |||   ||||||  ||| ||| |||||||||||||     |  | c
3'    cgu   ggguuc  uuc auc uccaacaugucaa     a  g a
   aca   ucu      cu   g   c             --uag gg a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
CM000943.1: 2619225-2619315 [-]
intergenic
Clustered miRNAs
< 10kb from aca-let-7c-3
aca-mir-100CM000943.1: 2624853-2624947 [-]
aca-let-7c-3CM000943.1: 2619225-2619315 [-]
Database links

Mature sequence aca-let-7c-5p

Accession MIMAT0021696
Previous IDsaca-let-7c
Sequence

11 - 

ugagguaguagguuguaugguu

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-let-7c-3-3p

Accession MIMAT0037557
Sequence

56 - 

cuguacaaccuccuagcuuucc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).