Stem-loop sequence gga-mir-1388a

AccessionMI0029345 (change log)
DescriptionGallus gallus miR-1388a stem-loop
Literature search

1 open access papers mention gga-mir-1388a
(1 sentences)

Stem-loop
   gc    -    c    a  a   u u         augg   aa a 
5'   gagg ggca cucg gg cug c aaccugaga    uga  c u
     |||| |||| |||| || ||| | |||||||||    |||  |  
3'   cucu ccgu gagu cc gac g uuggacucu    acu  g g
   --    u    a    a  c   u c         ---a   gg a 
Get sequence
Deep sequencing
50448 reads, 520 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr20: 9710454-9710541 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-1388a
gga-mir-1388achr20: 9710454-9710541 [+]
gga-mir-1388bchr20: 9710466-9710529 [-]
Database links

Mature sequence gga-miR-1388a-5p

Accession MIMAT0037555
Sequence

16 - 

aggacugucuaaccugagaaug

 - 37

Get sequence
Deep sequencing28513 reads, 5 experiments
Evidence experimental; Illumina [2]

Mature sequence gga-miR-1388a-3p

Accession MIMAT0037556
Sequence

55 - 

aucucagguucgucagcccaug

 - 76

Get sequence
Deep sequencing21934 reads, 5 experiments
Evidence experimental; Illumina [2]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).
2
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).