Stem-loop sequence gga-mir-210a

AccessionMI0029342 (change log)
DescriptionGallus gallus miR-210a stem-loop
Stem-loop
   ----c          g    a   acua       u  ----   u 
5'      aggagcaggu agcc cug    acgcaca ug    ugc c
        |||||||||| |||| |||    ||||||| ||    ||| u
3'      uccucgucca ucgg gac    ugcgugu ac    gcg c
   caggc          a    c   agug       c  cuca   g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 15887066-15887152 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-210a
gga-mir-210achr5: 15887066-15887152 [+]
gga-mir-210bchr5: 15887076-15887138 [-]
Database links

Mature sequence gga-miR-210a-5p

Accession MIMAT0037549
Sequence

13 - 

agccacugacuaacgcacauug

 - 34

Get sequence
Evidence experimental; Illumina [2]

Mature sequence gga-miR-210a-3p

Accession MIMAT0037550
Sequence

52 - 

cugugcgugugacagcggcuaa

 - 73

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).
2
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).