Stem-loop sequence gga-mir-203b

AccessionMI0029341 (change log)
DescriptionGallus gallus miR-203b stem-loop
Literature search

16 open access papers mention gga-mir-203b
(151 sentences)

Stem-loop
   --cg      gc    ca      c  a    u    caauuaug    a 
5'     ggccuc  uggu  aguggu cu aaca uuca        auag g
       ||||||  ||||  |||||| || |||| ||||        ||||  
3'     ucggag  acca  ucacca ga uugu aagu        uguc a
   ggag      ga    cg      a  a    c    --------    a 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 50769282-50769373 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-203b
gga-mir-203achr5: 50769283-50769380 [+]
gga-mir-203bchr5: 50769282-50769373 [-]
Database links

Mature sequence gga-miR-203b-3p

Accession MIMAT0037548
Sequence

55 - 

uugaacuguuaagaaccacugc

 - 76

Get sequence
Deep sequencing10 reads, 3 experiments
Evidence not experimental

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).