Stem-loop sequence gga-mir-182

AccessionMI0029339 (change log)
DescriptionGallus gallus miR-182 stem-loop
Literature search

5 open access papers mention gga-mir-182
(42 sentences)

Stem-loop
   -----     cuu       u -g      uca      ----   g 
5'      ggcug   uuggcaa g  uagaac   cacugg    ugc c
        |||||   ||||||| |  ||||||   ||||||    |||  
3'      ccgac   aaccguu c  aucuug   guggcc    acg u
   gggcc     auc       - ag      ---      uagg   c 
Get sequence
Deep sequencing
15714 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 843232-843313 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-182
gga-mir-183chr1: 844362-844459 [-]
gga-mir-96chr1: 844251-844336 [-]
gga-mir-182chr1: 843232-843313 [-]
Database links

Mature sequence gga-miR-182-5p

Accession MIMAT0037544
Sequence

8 - 

uuuggcaaugguagaacucacacug

 - 32

Get sequence
Deep sequencing15711 reads, 5 experiments
Evidence experimental; Illumina [2]

Mature sequence gga-miR-182-3p

Accession MIMAT0037545
Sequence

52 - 

ugguucuagacuugccaac

 - 70

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).
2
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).