Stem-loop sequence gga-mir-145

AccessionMI0029338 (change log)
DescriptionGallus gallus miR-145 stem-loop
Literature search

5 open access papers mention gga-mir-145
(26 sentences)

Stem-loop
   ---    cu       uc    u  c            ua      
5'    cgug  cucaggg  cagu uu ccaggaaucccu  ggcgc 
      ||||  |||||||  |||| || ||||||||||||  |||| u
3'    gcac  ggguucu  guca aa gguccuuagggg  uugca 
   ucg    cg       -u    u  a            --      
Get sequence
Deep sequencing
16228 reads, 120 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr13: 8492485-8492569 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-145
gga-mir-143chr13: 8493098-8493177 [-]
gga-mir-145chr13: 8492485-8492569 [-]
Database links

Mature sequence gga-miR-145-5p

Accession MIMAT0037542
Sequence

13 - 

guccaguuuucccaggaaucccuu

 - 36

Get sequence
Deep sequencing9178 reads, 5 experiments
Evidence experimental; Illumina [2]

Mature sequence gga-miR-145-3p

Accession MIMAT0037543
Sequence

53 - 

auuccuggaaauacuguucuu

 - 73

Get sequence
Deep sequencing7048 reads, 5 experiments
Evidence experimental; Illumina [2]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).
2
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).