Stem-loop sequence gga-mir-125b-1

AccessionMI0029337 (change log)
DescriptionGallus gallus miR-125b-1 stem-loop
Literature search

26 open access papers mention gga-mir-125b-1
(63 sentences)

Stem-loop
   guu    cc   u  -a    u    c           au        
5'    gcgc  cuc ca  uccc gaga ccuaacuugug  guuuagc 
      ||||  ||| ||  |||| |||| |||||||||||  |||||| u
3'    cgug  gag gu  aggg uucu ggauugggcac  uaaauuu 
   uuu    uu   u  cg    -    c           -c        
Get sequence
Deep sequencing
613244 reads, 6.76e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr24: 3360814-3360905 [+]
intergenic
Database links

Mature sequence gga-miR-125b-5p

Accession MIMAT0001105
Sequence

17 - 

ucccugagacccuaacuuguga

 - 38

Get sequence
Deep sequencing1220049 reads, 5 experiments
Evidence experimental; Illumina [2]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).